Part:BBa_K2015008:Design
RADA for multimer
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 82
Illegal BamHI site found at 802 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 64
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 731
Design Notes
This sequence contains two BamHI sites to replace enzymes.
You cannot cut this part by NdeI because GFP contains it.
You can amplify this fragment following two primers.
Forward: GGGTCTAGAATGGGTGGGTGCG(starting from XbaI site)
Reverse: CCCACTAGTTATTAGCCACCGCATCC(starting from SpeI site)
Source
gBlocks® Gene Fragments from IDT
References
[1] Liang P, Xiong J, Zhao L, Xu Y, Zhao J, Liu Q (2015) Recombinant self-assembling 16-residue peptide nanofiber scaffolds for neuronal axonal outgrowth. Eng. Life sci. 15(1): 152-158
[2] Nune M, Kumaraswamy P, Krishnan UM, Sethuraman S, (2013) Self-Assembling Peptide Nanofibrous Scaffolds for Tissue Engineering: Novel Approaches and Strategies for Effective Functional Regeneration. Curr. protein pept. sc. 14: 70-84.
[3] Reed CD, Barnard GC, Anderson EB, Klein LT, Gerngross TU (2006) Production and puriWcation of self-assembling peptides in Ralstonia eutropha. Protein expres. purif. 46: 179-188.
[4] Zhang S, Behnke RE, Zhao X, Spirio L, PuraMatrix: Self-assembling Peptide Nanofiber Scaffolds. Tissue eng.